Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid(BC028152)

Product Information

NCBI RefSeq: BC028152

RefSeq ORF Size: 1095

cDNA Description: Full length Clone DNA of Homo sapiens CD33 molecule.

Gene Synonym: p67,Siglec-3,SIGLEC3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD33/Siglec-3 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid HG12238-UTLN pLV-untagged 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12238-CFLN pLV-C-FLAG 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12238-CHLN pLV-C-His 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12238-CMLN pLV-C-Myc 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12238-CYLN pLV-C-HA 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12238-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12238-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12238-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12238-NHLN pLV-SP-N-His 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12238-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD33/Siglec-3 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12238-NYLN pLV-SP-N-HA 2-3 weeks

Background

Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3, is a member of the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. This Single-pass type I membrane protein contains 1 Ig-like C2-type (immunoglobulin-like) domain and 1 Ig-like V-type (immunoglobulin-like) domain. CD33 /Siglec-3 is a putative adhesion molecule of myelomonocytic-derived cells that mediates sialic-acid dependent binding to cells. CD33 /Siglec-3 preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. CD33/Siglec-3 induces apoptosis in acute myeloid leukemia (in vitro). CD33/Siglec-3 can function as a sialic acid-dependent cell adhesion molecule and that binding can be modulated by endogenous sialoglycoconjugates when CD33 is expressed in a plasma membrane.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Simmons D, et al. (1988) Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. J Immunol. 141(8): 2797-800.
  • Ulyanova T, et al. (1999) The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. Eur J Immunol. 29(11): 3440-9.
  • Freeman SD, et al. (1995) Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 85(8): 2005-12.