Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid(BC013572)

Product Information

NCBI RefSeq: BC013572

RefSeq ORF Size: 567

cDNA Description: Full length Clone DNA of Homo sapiens v-Ki-ras2 Kirsten rat sarcoma viral oncogene homol.

Gene Synonym: C-K-RAS,CFC2,K-RAS,K-RAS2A,K-RAS2B,K-RAS4A,K-RAS4B,KI-RAS,KRAS1,KRAS2,NS,NS3,RALD,RASK2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human KRAS/K-RAS Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid HG12259-UTLN pLV-untagged 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12259-CFLN pLV-C-FLAG 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12259-CHLN pLV-C-His 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12259-CMLN pLV-C-Myc 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12259-CYLN pLV-C-HA 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12259-ACGLN pLV-C-GFPSpark 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12259-ACRLN pLV-C-OFPSpark 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12259-NFLN pLV-SP-N-Flag 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12259-NHLN pLV-SP-N-His 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12259-NMLN pLV-SP-N-Myc 2-3 weeks
Human KRAS/K-RAS Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12259-NYLN pLV-SP-N-HA 2-3 weeks

Background

K-Ras belongs to the small GTPase superfamily, Ras family. As other members of the Ras family, K-Ras is a GTPase and is an early player in many signal transduction pathways. It is usually tethered to cell membranes because of the presence of an isoprenyl group on its C-terminus. K-Ras functions as a molecular on/off switch. Once it is turned on it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal, such as c-Raf and PI 3-kinase. It binds to GTP in the active state and possesses an intrinsic enzymatic activity which cleaves the terminal phosphate of the nucleotide converting it to GDP. Upon conversion of GTP to GDP, K-Ras is turned off. The rate of conversion is usually slow but can be sped up dramatically by an accessory protein of the GTPase activating protein class, for example RasGAP. In turn K-Ras can bind to proteins of the Guanine Nucleotide Exchange Factor class, for example SOS1, which forces the release of bound nucleotide. Subsequently, K-Ras binds GTP present in the cytosol and the GEF is released from ras-GTP. Besides essential function in normal tissue signaling, the mutation of a K-Ras gene is an essential step in the development of many cancers. Several germline K-Ras mutations have been found to be associated with Noonan syndrome[4] and cardio-facio-cutaneous syndrome. Somatic K-Ras mutations are found at high rates in Leukemias, colon cancer, pancreatic cancer and lung cancer.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Ling J, et al. (2012) KrasG12D-induced IKK2