Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD47 Gene Lentiviral ORF cDNA expression plasmid(BC010016)

Product Information

NCBI RefSeq: BC010016

RefSeq ORF Size: 918

cDNA Description: Full length Clone DNA of Homo sapiens CD47 molecule.

Gene Synonym: IAP,MER6,OA3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD47 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD47 Gene Lentiviral ORF cDNA expression plasmid HG12283-UTLN pLV-untagged 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12283-CFLN pLV-C-FLAG 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12283-CHLN pLV-C-His 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12283-CMLN pLV-C-Myc 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12283-CYLN pLV-C-HA 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12283-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12283-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12283-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12283-NHLN pLV-SP-N-His 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12283-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD47 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12283-NYLN pLV-SP-N-HA 2-3 weeks

Background

CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.