Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid(BC013780)

Product Information

NCBI RefSeq: BC013780

RefSeq ORF Size: 1239

cDNA Description: Full length Clone DNA of Homo sapiens adenosine A2a receptor.

Gene Synonym: A2aR,ADORA2,RDC8

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Adenosine Receptor A2a Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid HG12307-UTLN pLV-untagged 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12307-CFLN pLV-C-FLAG 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12307-CHLN pLV-C-His 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12307-CMLN pLV-C-Myc 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12307-CYLN pLV-C-HA 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12307-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12307-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12307-NFLN pLV-SP-N-Flag 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12307-NHLN pLV-SP-N-His 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12307-NMLN pLV-SP-N-Myc 2-3 weeks
Human Adenosine Receptor A2a Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12307-NYLN pLV-SP-N-HA 2-3 weeks

Background

This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding.

Immune Checkpoint
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Alchera E, Imarisio C, Mandili G, et al. Pharmacological Preconditioning by Adenosine A2a Receptor Stimulation: Features of the Protected Liver Cell Phenotype. BioMed Research International. 2015;2015:286746.