Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid(NM_002607.5)

Product Information

NCBI RefSeq: NM_002607.5

RefSeq ORF Size: 636

cDNA Description: Full length Clone DNA of Homo sapiens platelet-derived growth factor alpha polypeptide.

Gene Synonym: PDGF-A,PDGF1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PDGFA/PDGF-1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid HG13081-UTLN pLV-untagged 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13081-CFLN pLV-C-FLAG 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13081-CHLN pLV-C-His 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13081-CMLN pLV-C-Myc 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13081-CYLN pLV-C-HA 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13081-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13081-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13081-NFLN pLV-SP-N-Flag 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13081-NHLN pLV-SP-N-His 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13081-NMLN pLV-SP-N-Myc 2-3 weeks
Human PDGFA/PDGF-1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13081-NYLN pLV-SP-N-HA 2-3 weeks