Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid(NM_002001.2)

Product Information

NCBI RefSeq: NM_002001.2

RefSeq ORF Size: 774

cDNA Description: Full length Clone DNA of Homo sapiens Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide.

Gene Synonym: FCE1A,FcERI

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FcERI/FCER1A Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid HG13193-UTLN pLV-untagged 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13193-CFLN pLV-C-FLAG 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13193-CHLN pLV-C-His 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13193-CMLN pLV-C-Myc 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13193-CYLN pLV-C-HA 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13193-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13193-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13193-NFLN pLV-SP-N-Flag 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13193-NHLN pLV-SP-N-His 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13193-NMLN pLV-SP-N-Myc 2-3 weeks
Human FcERI/FCER1A Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13193-NYLN pLV-SP-N-HA 2-3 weeks

Background

FcERI, also known as FCER1A, is the alpha subunit of the immunoglobulin epsilon receptor (IgE receptor). IgE receptor is a high affinity IgE receptor which plays a central role in allergic disease, coupling allergen and mast cell to initiate the inflammatory and immediate hypersensitivity responses that are characteristic of disorders such as hay fever and asthma. The allergic response occurs when 2 or more IgE receptors are crosslinked via IgE molecules that in turn are bound to an allergen (antigen) molecule. A perturbation occurs that brings about the release of histamine and proteases from the granules in the cytoplasm of the mast cell and leads to the synthesis of prostaglandins and leukotrienes--potent effectors of the hypersensitivity response. IgE receptor is comprised of an alpha subunit(FcERI), a beta subunit, and two gamma subunits. FcERI is glycosylated and contains 2 Ig-like (immunoglobulin-like) domains.

Reference

  • Shikanai T, et al. (2002) Sequence variants in the FcepsilonRI alpha chain gene. J Appl Physiol. 93(1):37-41.
  • Sada K, et al. (2002) Regulation of FcepsilonRI-mediated degranulation by an adaptor protein 3BP2 in rat basophilic leukemia RBL-2H3 cells. Blood. 100(6):2138-44.
  • Takahashi K, et al. (2003) Transcriptional regulation of the human high affinity IgE receptor alpha-chain gene. Mol Immunol. 38(16-18):1193-9.