Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid(BC020568)

Product Information

NCBI RefSeq: BC020568

RefSeq ORF Size: 936

cDNA Description: Full length Clone DNA of Homo sapiens chromosome 10 open reading frame 54.

Gene Synonym: B7-H5,B7H5,DD1alpha,GI24,PP2135,SISP1,VISTA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human VISTA/GI24/B7-H5 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid HG13482-UTLN pLV-untagged 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13482-CFLN pLV-C-FLAG 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13482-CHLN pLV-C-His 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13482-CMLN pLV-C-Myc 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13482-CYLN pLV-C-HA 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13482-ACGLN pLV-C-GFPSpark 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13482-ACRLN pLV-C-OFPSpark 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13482-NFLN pLV-SP-N-Flag 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13482-NHLN pLV-SP-N-His 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13482-NMLN pLV-SP-N-Myc 2-3 weeks
Human VISTA/GI24/B7-H5 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13482-NYLN pLV-SP-N-HA 2-3 weeks

Background

C10orf54, also known as GI24, belongs to the immunoglobulin superfamily. It is a transmembrane molecule expressed in bone, on embryonic stem cells (ESCs), and on tumor cell surfaces. On ESCs, C10orf54 appears to positively interact with BMP-4, potentiating BMP signaling and the transition from an undifferentiated to a differentiated state. On tumor cells, C10orf54 both promotes MT1-MMP expression and activity and serves as a substrate for MT1-MMP. This increases the potential for cell motility. Human C10orf54 undergoes proteolytic cleavage by MT1-MMP, generating a soluble 30 kDa extracellular fragment plus a 25-30 kDa membrane-bound fragment.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies
VISTA / GI24 / B7-H5 Immune Checkpoint   VISTA / B7-H5 / GI24 Immune Checkpoint Antibodies   VISTA / B7-H5 / GI24 Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Deloukas P, et al. (2004) The DNA sequence and comparative analysis of human chromosome 10. Nature. 429(6990):375-81.
  • Colland F, et al. (2004) Functional proteomics mapping of a human signaling pathway. Genome Res. 14(7):1324-32.