Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid(BC002500)

Product Information

NCBI RefSeq: BC002500

RefSeq ORF Size: 1254

cDNA Description: Full length Clone DNA of Homo sapiens calreticulin.

Gene Synonym: cC1qR,CRT,HEL-S-99n,RO,SSA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Calreticulin Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid HG13539-UTLN pLV-untagged 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13539-CFLN pLV-C-FLAG 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13539-CHLN pLV-C-His 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13539-CMLN pLV-C-Myc 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13539-CYLN pLV-C-HA 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13539-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13539-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13539-NFLN pLV-SP-N-Flag 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13539-NHLN pLV-SP-N-His 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13539-NMLN pLV-SP-N-Myc 2-3 weeks
Human Calreticulin Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13539-NYLN pLV-SP-N-HA 2-3 weeks

Background

Calreticulin is a multifunctional protein. It acts as a main Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. Calreticulin binds Ca2+ ions (a second messenger in signal transduction), rendering it inactive. The Ca2+ is bound with low affinity, but high capacity, and can be released on a signal. Located in storage compartments associated with the endoplasmic reticulum, calreticulin also binds to misfolded proteins and prevents them from being exported from the endoplasmic reticulum to the golgi apparatus. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin reduces the binding of androgen receptor to its hormone-responsive DNA element and inhibits androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Therefore, calreticulin acts as a significant modulator of the regulation of gene transcription by nuclear hormone receptors.

Reference

  • Michalak M, et al. (2002) Calreticulin in cardiac development and pathology. Biochim Biophys Acta. 1600(1-2):32-7.
  • Chao MP, et al. (2010) Calreticulin is the dominant pro-phagocytic signal on multiple human cancers and is counterbalanced by CD47. Sci Transl Med. 2(63):63ra94.
  • Andrin, C, et al. (1998) Interaction between a Ca2+-binding protein calreticulin and perforin, a component of the cytotoxic T-cell granules. Biochemistry. 37(29):10386-94.