Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid(NM_004195.2)

Product Information

NCBI RefSeq: NM_004195.2

RefSeq ORF Size: 726

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 18.

Gene Synonym: AITR,CD357,GITR,GITR-D

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human GITR/TNFRSF18/CD357 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid HG13643-UTLN pLV-untagged 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13643-CFLN pLV-C-FLAG 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13643-CHLN pLV-C-His 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13643-CMLN pLV-C-Myc 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13643-CYLN pLV-C-HA 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13643-ACGLN pLV-C-GFPSpark 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13643-ACRLN pLV-C-OFPSpark 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13643-NFLN pLV-SP-N-Flag 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13643-NHLN pLV-SP-N-His 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13643-NMLN pLV-SP-N-Myc 2-3 weeks
Human GITR/TNFRSF18/CD357 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13643-NYLN pLV-SP-N-HA 2-3 weeks

Background

GITR, also known as TNFRSF18(CD357), belongs to the tumor necrosis factor receptor (TNF-R) superfamily. It is the receptor for TNFSF18. GITR plays a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. GITR may be involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. GITR and its ligand are important costimulatory molecules in the pathogenesis of autoimmune diseases. It also mediates NF-kappa-B activation via the TRAF2/NIK pathway.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Kwon B, et al. (1999) Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand. J Biol Chem. 274(10):6056-61.
  • Nocentini G, et al. (1997) A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci. 94(12): 6216-21.
  • Baltz KM, et al. (2007) Cancer immunoediting by GITR (glucocorticoid-induced TNF-related protein) ligand in humans: NK cell/tumor cell interactions. FASEB J. 21(10):2442-54.