Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid(BC036827)

Product Information

NCBI RefSeq: BC036827

RefSeq ORF Size: 1797

cDNA Description: Full length Clone DNA of Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2.

Gene Synonym: CD85D,ILT-4,ILT4,LIR-2,LIR2,MIR-10,MIR10

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human LILRB2/ILT4/LIR-2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid HG14132-UTLN pLV-untagged 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG14132-CFLN pLV-C-FLAG 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG14132-CHLN pLV-C-His 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG14132-CMLN pLV-C-Myc 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG14132-CYLN pLV-C-HA 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG14132-ACGLN pLV-C-GFPSpark 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG14132-ACRLN pLV-C-OFPSpark 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG14132-NFLN pLV-SP-N-Flag 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG14132-NHLN pLV-SP-N-His 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG14132-NMLN pLV-SP-N-Myc 2-3 weeks
Human LILRB2/ILT4/LIR-2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG14132-NYLN pLV-SP-N-HA 2-3 weeks

Background

ILT4, also known as LILRB2, is a member of the the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). ILT4 gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. Multiple transcript variants encoding different isoforms have been found for ILT4 gene. ILT4 is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity.

Reference

  • Colonna M., et al.,(1997), A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. J. Exp. Med. 186:1809-1818.
  • Borges L., et al., (1997), A family of human lymphoid and myeloid Ig-like receptors, some of which bind to MHC class I molecules.J. Immunol. 159:5192-5196.
  • Grimwood J., et al.,(2004), The DNA sequence and biology of human chromosome 19.Nature 428:529-535.