Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid(NM_002309.4)

Product Information

NCBI RefSeq: NM_002309.4

RefSeq ORF Size: 609

cDNA Description: Full length Clone DNA of Homo sapiens leukemia inhibitory factor.

Gene Synonym: CDF,DIA,HILDA,Leukemia Inhibitory Factor,MLPLI

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Leukemia Inhibitory Factor/LIF Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid HG14890-UTLN pLV-untagged 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG14890-CFLN pLV-C-FLAG 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG14890-CHLN pLV-C-His 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG14890-CMLN pLV-C-Myc 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG14890-CYLN pLV-C-HA 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG14890-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG14890-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG14890-NFLN pLV-SP-N-Flag 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG14890-NHLN pLV-SP-N-His 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG14890-NMLN pLV-SP-N-Myc 2-3 weeks
Human Leukemia Inhibitory Factor/LIF Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG14890-NYLN pLV-SP-N-HA 2-3 weeks

Background

Leukemia inhibitory factor (LIF) is a pleiotropic glycoprotein belonging to the IL-6 family of cytokines. It’s involved in growth promotion and cell differentiation of different types of target cells, influence on bone metabolism, cachexia, neural development, embryogenesis and inflammation. LIF has potent proinflammatory property, being the inducer of the acute phase protein synthesis and affecting the cell recruitment into the area of damage or inflammation. LIF is also one of the cytokines that are capable to regulate the differentiation of embryonic stem cells, hematopoietic and neuronal cells. LIF binds to the specific LIF receptor (LIFR-α) which forms a heterodimer with a specific subunit common to all members of that family of receptors, the GP130 signal transducing subunit. This leads to activation of the JAK/STAT and MAPK cascades. Due to its polyfunctional activities, LIF is involved in the pathogenic events and development of many diseases of various origin.

Reference

  • Salas EM, et al. (2011) LIF, a Novel STAT5-Regulated Gene, Is Aberrantly Expressed in Myeloproliferative Neoplasms. Genes Cancer. 2 (5): 593-6.
  • Chodorowska G, et al. (2004) Leukemia inhibitory factor (LIF) and its biological activity. Ann Univ Mariae Curie Sklodowska Med. 59 (2): 189-93.
  • Garcia-Campana AM, et al. (2007) LIF detection of peptides and proteins in CE. Electrophoresis. 28 (1-2): 208-32.