Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid(NM_003505.1)

Product Information

NCBI RefSeq: NM_003505.1

RefSeq ORF Size: 1944

cDNA Description: Full length Clone DNA of Homo sapiens frizzled family receptor 1.

Gene Synonym: FLJ95923; DKFZp564G072; FZD1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Frizzled-1/FZD1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid HG15229-UTLN pLV-untagged 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG15229-CFLN pLV-C-FLAG 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG15229-CHLN pLV-C-His 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG15229-CMLN pLV-C-Myc 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG15229-CYLN pLV-C-HA 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG15229-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG15229-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG15229-NFLN pLV-SP-N-Flag 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG15229-NHLN pLV-SP-N-His 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG15229-NMLN pLV-SP-N-Myc 2-3 weeks
Human Frizzled-1/FZD1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG15229-NYLN pLV-SP-N-HA 2-3 weeks

Background

Frizzled-1, also known as FZD1, belongs to the G-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.

Reference

  • Gazit A., et al.,(1999), Human frizzled 1 interacts with transforming Wnts to transduce a TCF dependent transcriptional response. Oncogene 18:5959-5966.
  • Sagara N., et al., (1998), Molecular cloning, differential expression, and chromosomal localization of human frizzled-1, frizzled-2, and frizzled-7.Biochem. Biophys. Res. Commun. 252:117-122.
  • Scherer S.W., et al.,(2003), Human chromosome 7: DNA sequence and biology.Science 300:767-772.