Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid(NM_000879.2)

Product Information

NCBI RefSeq: NM_000879.2

RefSeq ORF Size: 405

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 5 (colony-stimulating factor, eosinophil).

Gene Synonym: EDF,IL-5,TRF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL-5/IL5 / Interleukin 5 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid HG15673-UTLN pLV-untagged 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG15673-CFLN pLV-C-FLAG 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG15673-CHLN pLV-C-His 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG15673-CMLN pLV-C-Myc 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG15673-CYLN pLV-C-HA 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG15673-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG15673-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG15673-NFLN pLV-SP-N-Flag 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG15673-NHLN pLV-SP-N-His 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG15673-NMLN pLV-SP-N-Myc 2-3 weeks
Human IL-5/IL5 / Interleukin 5 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG15673-NYLN pLV-SP-N-HA 2-3 weeks

Background

Interleukin 5 (IL-5) is a member of the interleukin family with length of 115 amino acids. Interleukins are a group of cytokines (secreted proteins / signaling molecules) that were first seen to be expressed by white blood cells (leukocytes) and has been found in a wide variety of body cells. Interleukin 5 or IL-5 is produced by T helper-2 cells and mast cells. It helps to stimulate B cell growth and increase immunoglobulin secretion and is considered as a key mediator in eosinophil activation. Interleukin 5 (IL-5) has long been associated with several allergic diseases, including allergic rhinitis and asthma. Growth in the number of circulating, airway tissue, and induced sputum eosinophils have been observed in patients with these diseases. IL-5 also had something with the terminally differentiated granulocyte eosinophils. IL-5 was originally found as an eosinophil colony stimulating factor. It has been proved to be a major regulator of eosinophil accumulation in tissues, and can modulate eosinophil behavior at every stage from maturation to survival.

Reference

  • Milburn MV, et al. (1993) A novel dimer configuration revealed by the crystal structure at 2.4 A resolution of human interleukin-5. Nature. 363(6425): 172-176.
  • Lee JS, et al. (1989) The IL-4 and IL-5 genes are closely linked and are part of a cytokine gene cluster on mouse chromosome 11. Somat Cell Mol Genet. 15(2): 143-152.
  • Woodcock JM, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13 (21): 5176-85.