Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid(NM_003811.3)

Product Information

NCBI RefSeq: NM_003811.3

RefSeq ORF Size: 765

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 9.

Gene Synonym: 4-1BB-L,4-1BBL,CD137L

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD137L/4-1BBL/TNFSF9 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid HG15693-UTLN pLV-untagged 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG15693-CFLN pLV-C-FLAG 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG15693-CHLN pLV-C-His 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG15693-CMLN pLV-C-Myc 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG15693-CYLN pLV-C-HA 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG15693-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG15693-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG15693-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG15693-NHLN pLV-SP-N-His 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG15693-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD137L/4-1BBL/TNFSF9 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG15693-NYLN pLV-SP-N-HA 2-3 weeks

Background

4-1BBL is the high affinity ligand of 4-1BB, also known as CD137L or TNFSF9. It is shown to be a type II surface glycoprotein belonging to the TNF superfamily. Expression of 4-1BBL is restricted to APCs, such as dendritic cells, macrophages, and activated B cells. Members of the TNF-TNF receptor superfamily have been shown to play critical roles in regulating cellular activation, differentiation and apoptosis. Several studies have reported that 4-1BBL/4-1BB interaction provided a co-stimulatory signal to T cells, and increased T cell proliferation and cytokines production. In additon, 4-1BBL is involved in cancers, infectious diseases and autoimmune diseases.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: ICC Antibodies   Immune Checkpoint Detection: FCM Antibodies
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Cheung CT, (2007) Neutralizing anti-4-1BBL treatment improves cardiac function in viral myocarditis. Lab Invest. 87(7): 651-61.
  • Wang C, et al. (2009) Immune regulation by 4-1BB and 4-1BBL: complexities and challenges. Immunol Rev. 229(1): 192-215.
  • Habib-Agahi M, et al. (2009) 4-1BBL costimulation retrieves CD28 expression in activated T cells. Cell Immunol. 256(1-2): 39-46.