Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid(NM_174936.3)

Product Information

NCBI RefSeq: NM_174936.3

RefSeq ORF Size: 2079

cDNA Description: Full length Clone DNA of Homo sapiens proprotein convertase subtilisin/kexin type 9.

Gene Synonym: FH3,HCHOLA3,LDLCQ1,NARC-1,NARC1,PC9

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PCSK9/NARC1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid HG15813-UTLN pLV-untagged 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG15813-CFLN pLV-C-FLAG 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG15813-CHLN pLV-C-His 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG15813-CMLN pLV-C-Myc 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG15813-CYLN pLV-C-HA 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG15813-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG15813-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG15813-NFLN pLV-SP-N-Flag 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG15813-NHLN pLV-SP-N-His 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG15813-NMLN pLV-SP-N-Myc 2-3 weeks
Human PCSK9/NARC1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG15813-NYLN pLV-SP-N-HA 2-3 weeks

Background

Proprotein convertase subtilisin/kexin type 9 (PCSK9), also known as NARC1 (neural apoptosis regulated convertase), which is a newly identified human secretory subtilase belonging to the proteinase K subfamily of the secretory subtilase family. PCSK9 protein is an enzyme which in humans is encoded by the PCSK9 gene with orthologs found across many species. It is expressed in neuroepithelioma, colon carcinoma, hepatic and pancreatic cell lines, and in Schwann cells. PCSK9 protein is highly expressed in the liver and regulates low density lipoprotein receptor (LDLR) protein levels. Inhibition of PCSK9 protein function is currently being explored as a means of lowering cholesterol levels. Thereby, PCSK9 protein is regarded as a new strategy to treat hypercholesterolemia. PCSK9 protein contributes to cholesterol homeostasis and may have a role in the differentiation of cortical neurons.

References

Reference

  • Sseidah, N.G. et al., 2003, Proc. Natl. Acad. Sci. USA. 100: 928-933.
  • Beyer, T.P. et al., 2007, J. Lipid. Res. 48: 1488-1498
  • Shan, L. et al., 2008, Biochem. Biophys. Res. Commun. 375: 69-73.
  • Benjannet, S. et al., 2005, J. Biol. Chem. 279: 48865-48875.
  • Abifadel, M. et al., 2003, Nat. Genet. 34: 154-156.