Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid(NM_001013251.2)

Product Information

NCBI RefSeq: NM_001013251.2

RefSeq ORF Size: 1590

cDNA Description: Full length Clone DNA of Homo sapiens solute carrier family 3 (amino acid transporter heavy chain), member 2.

Gene Synonym: 4F2,4F2HC,4T2HC,CD98,CD98HC,MDU1,NACAE

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human CD98/SLC3A2/4F2HC Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid HG16415-UTLN pLV-untagged 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG16415-CFLN pLV-C-FLAG 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG16415-CHLN pLV-C-His 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG16415-CMLN pLV-C-Myc 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG16415-CYLN pLV-C-HA 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG16415-ACGLN pLV-C-GFPSpark 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG16415-ACRLN pLV-C-OFPSpark 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG16415-NFLN pLV-SP-N-Flag 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG16415-NHLN pLV-SP-N-His 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG16415-NMLN pLV-SP-N-Myc 2-3 weeks
Human CD98/SLC3A2/4F2HC Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG16415-NYLN pLV-SP-N-HA 2-3 weeks

Background

4F2 cell-surface antigen heavy chain, also known as 4F2 heavy chain antigen, Lymphocyte activation antigen 4F2 large subunit, CD98, SLC3A2 and MDU1, is a single-pass type I I membrane protein which belongs to the SLC3A transporter family. SLC3A2 / MDU1 is expressed ubiquitously in all tissues tested with highest levels detected in kidney, placenta and testis and weakest level in thymus. During gestation, expression in the placenta is significantly stronger at full-term than at the mid-trimester stage. SLC3A2 / MDU1 is expressed in HUVECS and at low levels in resting peripheral blood T-lymphocytes and quiescent fibroblasts. It is expressed in fetal liver and in the astrocytic process of primary astrocytic gliomas. SLC3A2 / MDU1 is also expressed in retinal endothelial cells and in the intestinal epithelial cell line Caco2-BBE. SLC3A2 / MDU1 is required for the function of light chain amino-acid transporters. It involved in sodium-independent, high-affinity transport of large neutral amino acids such as phenylalanine, tyrosine, leucine, arginine and tryptophan. SLC3A2 / MDU1 is involved in guiding and targeting of LAT1 and LAT2 to the plasma membrane. When associated with SLC7A6 or SLC7A7, SLC3A2 / MDU1 acts as an arginine/glutamine exchanger, following an antiport mechanism for amino acid transport, influencing arginine release in exchange for extracellular amino acids. SLC3A2 / MDU1 plays a role in nitric oxide synthesis in human umbilical vein endothelial cells (HUVECs) via transport of L-arginine. It is required for normal and neoplastic cell growth. When associated with SLC7A5/LAT1, SLC3A2 / MDU1 is also involved in the transport of L-DOPA across the blood-brain barrier, and that of thyroid hormones triiodothyronine (T3) and thyroxine (T4) across the cell membrane in tissues such as placenta.

Reference

  • Torrents D. et al., 1998, J Biol Chem. 273: 32437-45.
  • Pfeiffer R. et al., 1999, EMBO J. 18: 49-57.
  • Broeer A. et al., 2000, Biochem J. 349: 787-95.
  • Yanagida O. et al., 2001, Biochim Biophys Acta. 1514: 291-302.
  • Broeer A. et al., 2001, Biochem J. 355: 725-31.
  • Fort J. et al., 2007, J Biol Chem. 282: 31444-52.
  • Mayya V. et al., 2009, Sci Signal. 2: RA46-RA46.