Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid(NM_144559.1)

Product Information

NCBI RefSeq: NM_144559.1

RefSeq ORF Size: 750

cDNA Description: Full length Clone DNA of Mus musculus Fc receptor, IgG, low affinity IV.

Gene Synonym: 4833442P21Rik,CD16-2,FcgammaRIV,Fcgr3a,FcgRIV,Fcrl3

Species: Mouse

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Mouse CD16-2/FCGR4 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid MG50036-UTLN pLV-untagged 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag MG50036-CFLN pLV-C-FLAG 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, C-His tag MG50036-CHLN pLV-C-His 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag MG50036-CMLN pLV-C-Myc 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag MG50036-CYLN pLV-C-HA 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag MG50036-ACGLN pLV-C-GFPSpark 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag MG50036-ACRLN pLV-C-OFPSpark 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag MG50036-NFLN pLV-SP-N-Flag 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, N-His tag MG50036-NHLN pLV-SP-N-His 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag MG50036-NMLN pLV-SP-N-Myc 2-3 weeks
Mouse CD16-2/FCGR4 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag MG50036-NYLN pLV-SP-N-HA 2-3 weeks