Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid(NM_010775.2)

Product Information

NCBI RefSeq: NM_010775.2

RefSeq ORF Size: 720

cDNA Description: Full length Clone DNA of Mus musculus mannose-binding lectin (protein A) 1.

Gene Synonym: MBL-A,MBP-A,S-MBP

Species: Mouse

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Mouse MBL-1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid MG50069-UTLN pLV-untagged 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag MG50069-CFLN pLV-C-FLAG 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag MG50069-CHLN pLV-C-His 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag MG50069-CMLN pLV-C-Myc 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag MG50069-CYLN pLV-C-HA 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag MG50069-ACGLN pLV-C-GFPSpark 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag MG50069-ACRLN pLV-C-OFPSpark 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag MG50069-NFLN pLV-SP-N-Flag 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag MG50069-NHLN pLV-SP-N-His 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag MG50069-NMLN pLV-SP-N-Myc 2-3 weeks
Mouse MBL-1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag MG50069-NYLN pLV-SP-N-HA 2-3 weeks

Background

Mannose-binding lectin (MBL), also named mannose or mannan-binding protein (MBP), is a C-type lectin which participates in the innate immune system as an activator of the complement system and as opsonin after binding to certain carbohydrate structures on microorganisms and pathogens. Its function appears to be pattern recognition in the first line of defense in the pre-immune host. MBL recognizes carbohydrate patterns found on the surface of a large number of pathogenic micro-organisms including bacteria, viruses, protozoa and fungi. Binding of MBL to a micro-organism results in activation of the lectin pathway of the complement system. Two forms of MBL, MBL-A and MBL-C, were characterized in rodents, rabbits, bovine and rhesus monkeys, whereas only one form was identified in humans, chimpanzees and chickens. The two forms are encoded by two distinct genes named MBL1 and MBL2, which have been identified in many species including the pig. The MBL1 and MBL2 genes encode mannan-binding lectins (MBL) A and C, respectively, that are collagenous lectins (collectins) produced mainly by the liver. The MBL1 gene encodes MBL-A, which has bacteria-binding properties in pigs and rodents but is mutated to a pseudogene in humans and chimpanzees. Deficiency of MBL is probably the most common human immunodeficiency and is associated with an increased risk of mucosally acquired infections including meningococcal disease. MBL could modify disease susceptibility by modulating macrophage interactions with mucosal organisms at the site of initial acquisition.

Reference

  • Jack DL, et al. (2005) Mannose-binding lectin enhances phagocytosis and killing of Neisseria meningitidis by human macrophages. J Leukoc Biol. 77(3): 328-36.
  • Lillie BN, et al. (2006) Single-nucleotide polymorphisms in porcine mannan-binding lectin A. Immunogenetics. 58(12): 983-93.
  • Nikolakopoulou K, et al. (2006) Molecular cloning and characterisation of two homologues of Mannose-Binding Lectin in rainbow trout. Fish Shellfish Immunol. 21(3): 305-14.
  • Phatsara C, et al. (2007) Molecular genetic analysis of porcine mannose-binding lectin genes, MBL1 and MBL2, and their association with complement activity. Int J Immunogenet. 34(1): 55-63.