Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid(NM_015780.2)

Product Information

NCBI RefSeq: NM_015780.2

RefSeq ORF Size: 1032

cDNA Description: Full length Clone DNA of Mus musculus complement factor H-related 1

Gene Synonym: AI194696,Cfhl1,CFHRB

Species: Mouse

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Mouse CFHR1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid MG56538-UTLN pLV-untagged 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag MG56538-CFLN pLV-C-FLAG 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag MG56538-CHLN pLV-C-His 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag MG56538-CMLN pLV-C-Myc 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag MG56538-CYLN pLV-C-HA 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag MG56538-ACGLN pLV-C-GFPSpark 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag MG56538-ACRLN pLV-C-OFPSpark 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag MG56538-NFLN pLV-SP-N-Flag 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag MG56538-NHLN pLV-SP-N-His 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag MG56538-NMLN pLV-SP-N-Myc 2-3 weeks
Mouse CFHR1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag MG56538-NYLN pLV-SP-N-HA 2-3 weeks

Background

CFHR1 is a secreted protein belonging to the complement factor H protein family.The human complement factor H protein family consists of the complement and immune regulators factor H, the factor H-like protein 1(FHL-1) and five factor H-related proteins (CFHR-1 to -5). Members of the H-related protein family are exclusively composed of individually folded protein domains, termed short consensus repeats (SCRs) or complement control modules. CFHR1 binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. CFHR1 might be involved in complement regulation. It can associate with lipoproteins and may play a role in lipid metabolism.

Reference

  • Martnez-Barrica, et al. (2012) Relevance of complement factor H-related 1 (CFHR1) genotypes in age-related macular degeneration. Invest Ophthalmol Vis Sci. 53(3):1087-94.
  • Leban N, et al. (2012) Factor H and CFHR1 polymorphisms associated with atypical Haemolytic Uraemic Syndrome (aHUS) are differently expressed in Tunisian and in Caucasian populations. Int J Immunogenet. 39(2):110-3.
  • Kubista KE, et al. (2011) Copy number variation in the complement factor H-related genes and age-related macular degeneration. Int J Immunogenet. Mol Vis. 17:2080-92.