Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid(NM_002982.3)

Product Information

NCBI RefSeq: NM_002982.3

RefSeq ORF Size: 299

cDNA Description: Full length Clone DNA of Homo sapiens chemokine (C-C motif) ligand 2 with C terminal GFPSpark tag.

Gene Synonym: GDCF-2,HC11,HSMCR30,MCAF,MCP-1,MCP1,SCYA2,SMC-CF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MCP-1/CCL2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid HG10134-UTLN pLV-untagged 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10134-CFLN pLV-C-FLAG 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10134-CHLN pLV-C-His 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10134-CMLN pLV-C-Myc 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10134-CYLN pLV-C-HA 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10134-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10134-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10134-NFLN pLV-SP-N-Flag 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10134-NHLN pLV-SP-N-His 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10134-NMLN pLV-SP-N-Myc 2-3 weeks
Human MCP-1/CCL2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10134-NYLN pLV-SP-N-HA 2-3 weeks

Background

Monocyte chemoattractant protein 1 (MCP-1), also called CCL2, belongs to a group of CC chemokines located in chromosome 17q11.2. MCP-1 protein interacts with chemokine C-C motif receptor 2 (CCR2) to activate and recruit monocytes, macrophages, CD4+ T cells and immature dendritic cells to the site of infection [7

Reference

  • V