Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_003474.4)

Product Information

NCBI RefSeq: NM_003474.4

RefSeq ORF Size: 2721

cDNA Description: Full length Clone DNA of Homo sapiens ADAM metallopeptidase domain 12, transcript variant 1 with C terminal GFPSpark tag.

Gene Synonym: ADAM12-OT1,CAR10,MCMP,MCMPMltna,MLTN,MLTNA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ADAM12 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10896-UTLN pLV-untagged 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10896-CFLN pLV-C-FLAG 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10896-CHLN pLV-C-His 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10896-CMLN pLV-C-Myc 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10896-CYLN pLV-C-HA 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10896-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10896-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10896-NFLN pLV-SP-N-Flag 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10896-NHLN pLV-SP-N-His 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10896-NMLN pLV-SP-N-Myc 2-3 weeks
Human ADAM12 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10896-NYLN pLV-SP-N-HA 2-3 weeks

Background

The ADAMs (a disintegrin and metalloprotease) comprise a family of multidomain proteins with metalloprotease, cell adhesion, and signaling activities. Human ADAM12, which is implicated in diseases such as cancer, is expressed in two splice forms, the transmembrane ADAM12-L and the shorter and soluble ADAM12-S. ADAM12, also known as and Meltrin alpha, is a member of the ADAM protein family, which contains one disintegrin domain, one EGF-like domain and one peptidase M12B domain. ADAM12 is synthesized as a zymogen with the prodomain keeping the metalloprotease inactive through a cysteine-switch mechanism. Maturation and activation of the protease involves the cleavage of the prodomain in the trans-Golgi or possibly at the cell surface by a furin-peptidase. It is a membrane-anchored metalloprotease, which has been implicated in activation-inactivation of growth factors that play an important role in wound healing, including heparin-binding epidermal growth factor (EGF)-like growth factor (HB-EGF) and IGF binding proteins. ADAM12 may also regulate cell-cell and cell-extracellular matrix contacts through interactions with cell surface receptors - integrins and syndecans - potentially influencing the actin cytoskeleton. Moreover, ADAM12 interacts with several cytoplasmic signaling and adaptor molecules through its intracellular domain, thereby directly transmitting signals to or from the cell interior. These ADAM12-mediated cellular effects appear to be critical events in both biological and pathological processes. In addition to protease activity, ADAM12 possesses cell binding and cell signaling properties. In many studies, ADAM12 overexpression has been correlated with disease, and ADAM12 has been shown to promote tumor growth and progression in cancer. On the other hand, protective effects of ADAM12 in disease have also been reported.

Reference

  • Wewer UM, et al. (2006) ADAM12 is a four-leafed clover: the excised prodomain remains bound to the mature enzyme. J Biol Chem. 281(14): 9418-22.
  • Kveiborg M, et al. (2008) Cellular roles of ADAM12 in health and disease. Int J Biochem Cell Biol. 40(9): 1685-702.
  • Harsha A, et al. (2008) ADAM12: a potential target for the treatment of chronic wounds. J Mol Med. 86(8): 961-9.
  • Jacobsen J, et al. (2009) Targeting ADAM12 in human disease: head, body or tail? Curr Pharm Des. 15(20): 2300-10.
  • Baertling F, et al. (2010) ADAM12 is expressed by astrocytes during experimental demyelination. Brain Res. 1326: 1-14.