Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid(NM_001093772.1)

Product Information

NCBI RefSeq:

NM_001093772.1

RefSeq ORF Size:

2919

cDNA Description:

Full length Clone DNA of Homo sapiens YY1 associated protein 1

Gene Synonym:

PBT; SCFR; C-Kit; CD117

Species:

Human

Sequence Description:

Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers:

pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter:

Enhanced CMV mammalian cell promoter

Application:

Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli:

Ampicillin

Shipping carrier:

Each tube contains 10

Storage:

The lyophilized plasmid can be stored at room temperature for three months

Description Catalog Vector Sequence Data Sheet Availability
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid HG82115-UTLN pLV-untagged 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG82115-CFLN pLV-C-FLAG 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG82115-CHLN pLV-C-His 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG82115-CMLN pLV-C-Myc 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG82115-CYLN pLV-C-HA 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG82115-ACGLN pLV-C-GFPSpark 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG82115-ACRLN pLV-C-OFPSpark 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG82115-NFLN pLV-SP-N-Flag 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG82115-NHLN pLV-SP-N-His 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG82115-NMLN pLV-SP-N-Myc 2-3 weeks
Human KIT / c-KIT / CD117 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG82115-NYLN pLV-SP-N-HA 2-3 weeks