Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_002745.4)

Product Information

NCBI RefSeq: NM_002745.4

RefSeq ORF Size: 1083

cDNA Description: Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 1 (MAPK1), transcript variant 1.

Gene Synonym: ERK,ERK-2,ERK2,ERT1,MAPK2,p38,p40,p41,p41mapk,p42-MAPK,P42MAPK,PRKM1,PRKM2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10030-UTLN pLV-untagged 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10030-CFLN pLV-C-FLAG 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10030-CHLN pLV-C-His 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10030-CMLN pLV-C-Myc 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10030-CYLN pLV-C-HA 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10030-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10030-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10030-NFLN pLV-N-Flag 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10030-NHLN pLV-N-His 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10030-NMLN pLV-N-Myc 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10030-NYLN pLV-N-HA 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10030-ANGLN pLV-N-GFPSpark 2-3 weeks
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10030-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. ERK is a versatile protein kinase that regulates many cellular functions. Growing evidence suggests that extracellular signal-regulated protein kinase 1/2 (ERK1/2) plays a crucial role in promoting cell death in a variety of neuronal systems, including neurodegenerative diseases. It is believed that the magnitude and the duration of ERK1/2 activity determine its cellular function. Activation of ERK1/2 are implicated in the pathophysiology of spinal cord injury (SCI). ERK2 signaling is a novel target associated with the deleterious consequences of spinal injury. ERK-2, also known as Mitogen-activated protein kinase 1 (MAPK1), is a member of the protein kinase superfamily and MAP kinase subfamily. MKP-3 is a dual specificity phosphatase exclusively specific to MAPK1 for its substrate recognition and dephosphorylating activity. The activation of MAPK1 requires its phosphorylation by upstream kinases. Upon activation, MAPK1 translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. MAPK1 is involved in both the initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors such as ELK1. MAPK1 acts as a transcriptional repressor which represses the expression of interferon gamma-induced genes. Transcriptional activity is independent of kinase activity. The nuclear-cytoplasmic distribution of ERK2 is regulated in response to various stimuli and changes in cell context. Furthermore, the nuclear flux of ERK2 occurs by several energy- and carrier-dependent and -independent mechanisms. ERK2 has been shown to translocate into and out of the nucleus by facilitated diffusion through the nuclear pore, interacting directly with proteins within the nuclear pore complex, as well as by karyopherin-mediated transport. ERK2 interacts with the PDE4 catalytic unit by binding to a KIM (kinase interaction motif) docking site located on an exposed beta-hairpin loop and an FQF (Phe-Gln-Phe) specificity site located on an exposed alpha-helix. These flank a site that allows phosphorylation by ERK, the functional outcome of which is orchestrated by the N-terminal UCR1/2 (upstream conserved region 1 and 2) modules.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Houslay MD, et al. (2003) The role of ERK2 docking and phosphorylation of PDE4 cAMP phosphodiesterase isoforms in mediating cross-talk between the cAMP and ERK signalling pathways. Biochem Soc Trans. 31(Pt 6): 1186-90.
  • Jivan A, et al. (2010) Reconstitution of the Nuclear Transport of the MAP Kinase ERK2. Methods Mol Biol. 661: 273-85.
  • Yu CG, et al. (2010) Involvement of ERK2 in traumatic spinal cord injury. J Neurochem. 113(1): 131-42.
  • Subramaniam S, et al. (2010) ERK and cell death: ERK1/2 in neuronal death. FEBS J. 277(1): 22-9.