Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid(NM_000639.1)

Product Information

NCBI RefSeq: NM_000639.1

RefSeq ORF Size: 842

cDNA Description: Full length Clone DNA of Homo sapiens Fas ligand (TNF superfamily, member 6) (FASLG).

Gene Synonym: ALPS1B,APT1LG1,APTL,CD178,CD95-L,CD95L,FASL,FASLG,TNFSF6,TNLG1A

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Fas Ligand / FASLG / CD95L Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid HG10244-UTLN pLV-untagged 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10244-CFLN pLV-C-FLAG 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10244-CHLN pLV-C-His 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10244-CMLN pLV-C-Myc 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10244-CYLN pLV-C-HA 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10244-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10244-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10244-NFLN pLV-N-Flag 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10244-NHLN pLV-N-His 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10244-NMLN pLV-N-Myc 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10244-NYLN pLV-N-HA 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10244-ANGLN pLV-N-GFPSpark 2-3 weeks
Human Fas Ligand / FASLG / CD95L Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10244-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Fas Ligand, also known as FASLG and CD95L, is the ligand for FAS. It is a transmembrane protein which binds to TNFRSF6/FAS. Interaction of FAS with fas Ligand is critical in triggering apoptosis of some types of cells such as lymphocytes. Fas Ligand may be involved in cytotoxic T-cell mediated apoptosis and in T-cell development. TNFRSF6/FAS-mediated apoptosis may have a role in the induction of peripheral tolerance, in the antigen-stimulated suicide of mature T-cells, or both.

Reference

  • Pitti R M. et al., 1998, Nature. 396 (6712): 699-703.
  • Hane M. et al., 1995, FEBS Lett. 373 (3): 265-8.
  • Schneider P. et al., 1997, J Biol Chem. 272 (30): 18827-33.