Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_004113.4)

Product Information

NCBI RefSeq: NM_004113.4

RefSeq ORF Size: 546

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 12, transcript variant 2.

Gene Synonym: FGF12B,FHF1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF12 / FGF-12 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10312-UTLN pLV-untagged 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10312-CFLN pLV-C-FLAG 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10312-CHLN pLV-C-His 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10312-CMLN pLV-C-Myc 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10312-CYLN pLV-C-HA 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10312-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10312-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10312-NFLN pLV-N-Flag 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10312-NHLN pLV-N-His 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10312-NMLN pLV-N-Myc 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10312-NYLN pLV-N-HA 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10312-ANGLN pLV-N-GFPSpark 2-3 weeks
Human FGF12 / FGF-12 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10312-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

FGF12 is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth, and invasion. FGF12 lacks the N-terminal signal sequence present in most of the FGF family members, but it contains clusters of basic residues that have been demonstrated to act as a nuclear localization signal. When transfected into mammalian cells, FGF12 accumulated in the nucleus, but was not secreted. The specific function of FGF12 gene has not yet been determined. Two alternatively spliced transcript variants encoding distinct isoforms have been reported.

Reference

  • Liu Y. et al., 1997, Cytogenet Cell Genet. 78 (1): 48-9.
  • Robertson NG. et al., 1995, Genomics. 23 (1): 42-50.
  • Smallwood PM. et al., 1996, Proc Natl Acad Sci. 93 (18): 9850-7.