Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_004115.3)

Product Information

NCBI RefSeq: NM_004115.3

RefSeq ORF Size: 744

cDNA Description: Full length Clone DNA of Homo sapiens fibroblast growth factor 14.

Gene Synonym: FGF-14,FHF-4,FHF4,SCA27

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human FGF14/SCA27 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10893-UTLN pLV-untagged 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10893-CFLN pLV-C-FLAG 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10893-CHLN pLV-C-His 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10893-CMLN pLV-C-Myc 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10893-CYLN pLV-C-HA 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10893-ACGLN pLV-C-GFPSpark 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10893-ACRLN pLV-C-OFPSpark 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10893-NFLN pLV-N-Flag 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10893-NHLN pLV-N-His 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10893-NMLN pLV-N-Myc 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10893-NYLN pLV-N-HA 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10893-ANGLN pLV-N-GFPSpark 2-3 weeks
Human FGF14/SCA27 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10893-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

FGF14 is a member of the fibroblast growth factor (FGF) family. Members of this family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGF14 is probably involved in nervous system development and function. Defects in FGF14 are the cause of spinocerebellar ataxia type 27 (SCA27). It is a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA27 is an autosomal dominant cerebellar ataxia. It is a slowly progressive disorder, with onset in late-childhood to early adulthood, characterized by ataxia with tremor, orofacial dyskinesia, psychiatric symptoms and cognitive deficits.

Reference

  • Wang Q, et al. (2002) Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14. Neuron. 35 (1): 25-38.
  • Zhao Y, et al. (2007) Genetic analysis of SCA 27 in ataxia and childhood onset postural tremor. Am J Med Genet. 144B (3): 395-6.
  • Lou JY, et al. (2005) Fibroblast growth factor 14 is an intracellular modulator of voltage-gated sodium channels. J Physiol. 569 (1): 179-93.