Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human GSK3B Gene Lentiviral ORF cDNA expression plasmid(NM_001146156.1)

Product Information

NCBI RefSeq: NM_001146156.1

RefSeq ORF Size: 1263

cDNA Description: Full length Clone DNA of Homo sapiens glycogen synthase kinase 3 beta.

Gene Synonym: GSK3B

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human GSK3B Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid HG10044-UTLN pLV-untagged 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10044-CFLN pLV-C-FLAG 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10044-CHLN pLV-C-His 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10044-CMLN pLV-C-Myc 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10044-CYLN pLV-C-HA 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10044-ACGLN pLV-C-GFPSpark 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10044-ACRLN pLV-C-OFPSpark 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10044-NFLN pLV-N-Flag 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10044-NHLN pLV-N-His 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10044-NMLN pLV-N-Myc 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10044-NYLN pLV-N-HA 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10044-ANGLN pLV-N-GFPSpark 2-3 weeks
Human GSK3B Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10044-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

GSK3B is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It Contains 1 protein kinase domain, and is expressed in testis, thymus, prostate and ovary and weakly expressed in lung, brain and kidney. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in GSK3B gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. GSK3B participates in the Wnt signaling pathway. It is implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. GSK3B also plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. GSK3B phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. It may be required for early embryo development and neuron differentiation.

Reference

  • Bergmann C, et al. (2011) Inhibition of glycogen synthase kinase 3