Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid(NM_002128.4)

Product Information

NCBI RefSeq: NM_002128.4

RefSeq ORF Size: 648

cDNA Description: Full length Clone DNA of Homo sapiens high mobility group box 1

Gene Synonym: HMG-1,HMG1,HMG3,SBP-1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human HMGB1/HMG1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid HG10326-UTLN pLV-untagged 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10326-CFLN pLV-C-FLAG 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10326-CHLN pLV-C-His 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10326-CMLN pLV-C-Myc 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10326-CYLN pLV-C-HA 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10326-ACGLN pLV-C-GFPSpark 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10326-ACRLN pLV-C-OFPSpark 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10326-NFLN pLV-N-Flag 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10326-NHLN pLV-N-His 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10326-NMLN pLV-N-Myc 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10326-NYLN pLV-N-HA 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10326-ANGLN pLV-N-GFPSpark 2-3 weeks
Human HMGB1/HMG1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10326-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

High-mobility group box 1 protein (HMGB1), also known as HMG-1 or amphoterin previously, is a member of the HMGB family consisting of three members, HMGB1, HMGB2 and HMGB3. HMGB1 is a DNA-binding nuclear protein, released actively following cytokine stimulation as well as passively during cell death. It is the prototypic damage-associated molecular pattern (DAMP) molecule and has been implicated in several inflammatory disorders. HMGB1 signals via the receptor for advanced glycation end-product (RAGE) and members of the toll-like receptor (TLR) family. The most prominent HMGB1 protein and mRNA expression arthritis is present in pannus regions, where synovial tissue invades articular cartilage and bone. HMGB1 promotes the activity of proteolytic enzymes, and osteoclasts need HMGB1 for functional maturation. As a non-histone nuclear protein, HMGB1 has a dual function. Inside the cell, HMGB1 binds DNA, regulating transcription and determining chromosomal architecture. Outside the cell, HMGB1 can serve as an alarmin to activate the innate system and mediate a wide range of physiological and pathological responses. Extracellular HMGB1 represents an optimal "necrotic marker" selected by the innate immune system to recognize tissue damage and initiate reparative responses. However, extracellular HMGB1 also acts as a potent pro-inflammatory cytokine that contributes to the pathogenesis of diverse inflammatory and infectious disorders. HMGB1 has been successfully therapeutically targeted in multiple preclinical models of infectious and sterile diseases including arthritis. As shown in studies on patients as well as animal models, HMGB1 can play an important role in the pathogenesis of rheumatic disease, including rheumatoid arthritis, systemic lupus erythematosus, and polymyositis among others. In addition, enhanced postmyocardial infarction remodeling in type 1 diabetes mellitus was partially mediated by HMGB1 activation.

Reference

  • Ulloa L, et al. (2006) High-mobility group box 1 (HMGB1) protein: friend and foe. Cytokine Growth Factor Rev. 17 (3): 189-201.
  • Pisetsky DS, et al. (2008) High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease. Arthritis Res Ther. 10 (3): 209.
  • Volz HC, et al. (2010) The role of HMGB1/RAGE in inflammatory cardiomyopathy. Semin Thromb Hemost. 36(2): 185-94.
  • Sims GP, et al. (2010) HMGB1 and RAGE in inflammation and cancer. Annu Rev Immunol. 28: 367-88.
  • Andersson U, et al. (2010) The role of HMGB1 in the pathogenesis of rheumatic disease. Biochim Biophys Acta. 1799 (1-2): 141-8.