Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid(NM_002156.4)

Product Information

NCBI RefSeq: NM_002156.4

RefSeq ORF Size: 1722

cDNA Description: Full length Clone DNA of Homo sapiens heat shock 60kDa protein 1 (chaperonin).

Gene Synonym: CPN60,GROEL,HLD4,HSP-60,HSP60,HSP65,HuCHA60,SPG13

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human HSPD1/HSP60 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid HG11322-UTLN pLV-untagged 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11322-CFLN pLV-C-FLAG 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11322-CHLN pLV-C-His 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11322-CMLN pLV-C-Myc 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11322-CYLN pLV-C-HA 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11322-ACGLN pLV-C-GFPSpark 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11322-ACRLN pLV-C-OFPSpark 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11322-NFLN pLV-N-Flag 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11322-NHLN pLV-N-His 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11322-NMLN pLV-N-Myc 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11322-NYLN pLV-N-HA 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11322-ANGLN pLV-N-GFPSpark 2-3 weeks
Human HSPD1/HSP60 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11322-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

HSPD1, also known as HSP60, is a member of the chaperonin family. HSPD1 may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. It may also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. HSPD1 gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.Defects in HSPD1 are a cause of spastic paraplegia autosomal dominant type 13 (SPG13). Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Defects in HSPD1 are the cause of leukodystrophy hypomyelinating type 4 (HLD4); also called mitochondrial HSP60 chaperonopathy or MitCHAP-60 disease. HLD4 is a severe autosomal recessive hypomyelinating leukodystrophy. HSPD1 is cinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurrs within the first two decades of life.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Hansen J J, et al. (2002) Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60. Am J Hum Genet. 70: 1328-32.
  • Magen D, et al. (2008) Mitochondrial Hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy. Am J Hum Genet. 83: 30-42.
  • Venner TJ, et al. (1990) Nucleotide sequences and novel structural features of human and Chinese hamster hsp60 (chaperonin) gene families. DNA Cell Biol. 9 (8): 545-52.