Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid(NM_002164.4)

Product Information

NCBI RefSeq: NM_002164.4

RefSeq ORF Size: 1212

cDNA Description: Full length Clone DNA of Homo sapiens indoleamine 2,3-dioxygenase 1.

Gene Synonym: IDO,IDO-1,INDO,Indoleamine 2,3?dioxygenase

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IDO1/Indoleamine 2,3‑dioxygenase Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid HG11650-UTLN pLV-untagged 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11650-CFLN pLV-C-FLAG 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11650-CHLN pLV-C-His 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11650-CMLN pLV-C-Myc 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11650-CYLN pLV-C-HA 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11650-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11650-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11650-NFLN pLV-N-Flag 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11650-NHLN pLV-N-His 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11650-NMLN pLV-N-Myc 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11650-NYLN pLV-N-HA 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11650-ANGLN pLV-N-GFPSpark 2-3 weeks
Human IDO1/Indoleamine 2,3?dioxygenase Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11650-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Indoleamine 2,3-dioxygenase-1, also known as Indoleamine-pyrrole 2,3-dioxygenase, IDO1 and IDO, is a member of the indoleamine 2,3-dioxygenase family. IDO1 / IDO and tryptophan 2,3-dioxygenase (TDO) are tryptophan-degrading enzymes that catalyze the first step in tryptophan catabolism via the kynurenine pathway. TDO is widely distributed in both eukaryotes and bacteria. In contrast, IDO has been found only in mammals and yeast. In 2007, a third enzyme, indoleamine 2,3-dioxygenase-2 (IDO2), was discovered. IDO2 is found not only in mammals but also in lower vertebrates. IDO1 / IDO is an immunosuppressive molecule inducible in various cells. IDO1 / IDO catalyzes the cleavage of the pyrrol ring of tryptophan and incorporates both atoms of a molecule of oxygen. It mediates oxidative cleavage of tryptophan, an amino acid essential for cell proliferation and survival. IDO1 / IDO inhibition is proposed to have therapeutic potential in immunodeficiency-associated abnormalities, including cancer. The IDO pathway is activated in multiple tumor types. Selective inhibition of IDO1 may represent an attractive cancer therapeutic strategy via up-regulation of cellular immunity. IDO1 / IDO is an enzyme that suppresses adaptive T-cell immunity by catabolizing tryptophan from the cellular microenvironment. Inhibition of IDO pathway might enhance the efficacy of immunotherapeutic strategies for cancer.

Immune Checkpoint
Immune Checkpoint Detection: ELISA Antibodies
Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Barnes NA. et al., 2009, J Immunol. 183 (9): 5768-77.
  • Yuasa HJ. et al., 2009, Comp Biochem Physiol B Biochem Mol Biol. 153 (2): 137-44.
  • L b S. et al., 2009, Cancer Immunol Immunother. 58 (1): 153-7.
  • Liu,X. et al., 2010, Blood.115 (17): 3520-30.
  • Sun,T. et al., 2010, Mol Cell Biochem. 342 (1-2): 29-34.
  • Kiank C. et al., 2010, PLoS One. 5 (7): e11825.