Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human IL-33 Gene Lentiviral ORF cDNA expression plasmid(NM_033439.2)

Product Information

NCBI RefSeq: NM_033439.2

RefSeq ORF Size: 813

cDNA Description: Full length Clone DNA of Homo sapiens interleukin 33.

Gene Synonym: C9orf26,DVS27,IL1F11,NF-HEV,NFEHEV

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human IL-33 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid HG10368-UTLN pLV-untagged 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10368-CFLN pLV-C-FLAG 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10368-CHLN pLV-C-His 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10368-CMLN pLV-C-Myc 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10368-CYLN pLV-C-HA 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10368-ACGLN pLV-C-GFPSpark 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10368-ACRLN pLV-C-OFPSpark 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10368-NFLN pLV-N-Flag 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10368-NHLN pLV-N-His 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10368-NMLN pLV-N-Myc 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10368-NYLN pLV-N-HA 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10368-ANGLN pLV-N-GFPSpark 2-3 weeks
Human IL-33 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10368-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial enules), is a proinflammatory protein and a chromatin-associated cytokine of the IL-1 family with high sequence and structural similarity to IL-1 and IL-18. IL-33 protein is expressed highly and rather selectively by high endothelial venule endothelial cells (HEVECs) in human tonsils, Peyers's patches, and lymph nodes. IL-33 protein has transcriptional regulatory properties, and the researches suggested that IL-33 is a dual-function protein that might act both as a cytokine and as an intracellular nuclear factor. As a type 2 cytokines, IL-33 protein also play a pivotal role in helminthic infection and allergic disorders.

Reference

  • Iikura M, et al. (2007) IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87(10): 971-8.
  • Lamkanfi M, et al. (2009) IL-33 raises alarm. Immunity. 31(1): 5-7.