Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human Lck Gene Lentiviral ORF cDNA expression plasmid(NM_001042771.1)

Product Information

NCBI RefSeq: NM_001042771.1

RefSeq ORF Size: 1530

cDNA Description: Full length Clone DNA of Homo sapiens lymphocyte-specific proteintyrosine kinase (LCK), transcript variant 1.

Gene Synonym: IMD22,LSK,p56lck,pp58lck,YT16

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human Lck Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human Lck Gene Lentiviral ORF cDNA expression plasmid HG10043-UTLN pLV-untagged 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10043-CFLN pLV-C-FLAG 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10043-CHLN pLV-C-His 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10043-CMLN pLV-C-Myc 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10043-CYLN pLV-C-HA 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10043-ACGLN pLV-C-GFPSpark 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10043-ACRLN pLV-C-OFPSpark 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10043-NFLN pLV-N-Flag 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10043-NHLN pLV-N-His 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10043-NMLN pLV-N-Myc 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10043-NYLN pLV-N-HA 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10043-ANGLN pLV-N-GFPSpark 2-3 weeks
Human Lck Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10043-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Protein kinases are critically involved in signaling pathways that regulate cell growth, differentiation, activation, and survival. Initially identified as a T-cell specific member of the Src family of protein tyrosine kinases, Lck has become the object of intensive investigations which have revealed a key role for this kinase in the central processes controlling T-cell development, activation, proliferation and survival. Lck is expressed specifically in lymphoid cells. It contains one protein kinase domain, one SH2 domain, and one SH3 domain. It is associated with a variety of cell surface receptors and is critical for signal transduction from the T-cell antigen receptor (TCR). Consequently, Lck is targeted by regulatory proteins of T-lymphotropic viruses, especially by the Herpesvirus saimiri (HVS) tyrosine kinase interacting protein (Tip). This oncoprotein physically interacts with Lck in HVS transformed T cells and has an impact on its catalytic activity. Together with the identification of defects in the regulation of Lck expression or activity in T-cell leukemias, suggests that dysregulation of Lck might play a role in neoplastic transformation. However, under certain conditions Lck is also involved in the induction of apoptosis. This chemosensitizing effect of Lck is independent of T-cell receptor signaling and does not require the kinase activity of Lck. The findings demonstrate that Lck might be part of two independent signaling pathways leading to either cell proliferation or apoptosis.

Reference

  • Majolini MB, et al. (1999) Dysregulation of the protein tyrosine kinase LCK in lymphoproliferative disorders and in other neoplasias. Leuk Lymphoma. 35(3-4): 245-54.
  • Isakov N, et al. (2000) Lck protein tyrosine kinase is a key regulator of T-cell activation and a target for signal intervention by Herpesvirus saimiri and other viral gene products. Eur J Biochem. 267(12): 3413-21.
  • Heyninck K, et al. (2006) A novel link between Lck, Bak expression and chemosensitivity. Oncogene. 25(12): 1693-5.