Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human LCP1 Gene Lentiviral ORF cDNA expression plasmid(BC007673)

Product Information

NCBI RefSeq: BC007673

RefSeq ORF Size: 1884

cDNA Description: Full length Clone DNA of Homo sapiens lymphocyte cytosolic protein 1 (L-plastin).

Gene Synonym: CP64,HEL-S-37,L-PLASTIN,LC64P,LPL,PLS2

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human LCP1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid HG15013-UTLN pLV-untagged 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG15013-CFLN pLV-C-FLAG 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG15013-CHLN pLV-C-His 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG15013-CMLN pLV-C-Myc 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG15013-CYLN pLV-C-HA 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG15013-ACGLN pLV-C-GFPSpark 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG15013-ACRLN pLV-C-OFPSpark 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG15013-NFLN pLV-N-Flag 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG15013-NHLN pLV-N-His 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG15013-NMLN pLV-N-Myc 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG15013-NYLN pLV-N-HA 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG15013-ANGLN pLV-N-GFPSpark 2-3 weeks
Human LCP1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG15013-ANRLN pLV-N-OFPSpark 2-3 weeks