Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid(BC005930)

Product Information

NCBI RefSeq: BC005930

RefSeq ORF Size: 723

cDNA Description: Full length Clone DNA of Homo sapiens CD58 molecule.

Gene Synonym: ag3,CD58,LFA-3,LFA3

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human LFA-3 / CD58 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid HG12409-UTLN pLV-untagged 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG12409-CFLN pLV-C-FLAG 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG12409-CHLN pLV-C-His 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG12409-CMLN pLV-C-Myc 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG12409-CYLN pLV-C-HA 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG12409-ACGLN pLV-C-GFPSpark 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG12409-ACRLN pLV-C-OFPSpark 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG12409-NFLN pLV-N-Flag 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG12409-NHLN pLV-N-His 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG12409-NMLN pLV-N-Myc 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG12409-NYLN pLV-N-HA 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG12409-ANGLN pLV-N-GFPSpark 2-3 weeks
Human LFA-3 / CD58 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG12409-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Rochelle JM. et al., 1993, Int Immunol. 5 (2): 209-16.
  • Virtaneva KI. et al., 1993, Immunogenetics. 37 (6): 461-5.
  • Horejs