Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid(NM_002755.3)

Product Information

NCBI RefSeq: NM_002755.3

RefSeq ORF Size: 1182

cDNA Description: Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 1.

Gene Synonym: CFC3,MAPKK1,MEK1,MKK1,PRKMK1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MEK1/MAP2K1/MKK1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid HG10661-UTLN pLV-untagged 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10661-CFLN pLV-C-FLAG 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10661-CHLN pLV-C-His 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10661-CMLN pLV-C-Myc 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10661-CYLN pLV-C-HA 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10661-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10661-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10661-NFLN pLV-N-Flag 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10661-NHLN pLV-N-His 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10661-NMLN pLV-N-Myc 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10661-NYLN pLV-N-HA 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10661-ANGLN pLV-N-GFPSpark 2-3 weeks
Human MEK1/MAP2K1/MKK1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10661-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

MEK1, also known as MAP2K1 and MKK1, is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. MEK1 is widely expressed, with extremely low levels in brain. It lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, MEK1 is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. Binding extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1 and MEK2. MEK1 has been shown to export PPARG from the nucleus. The MAPK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis. MKK1 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. Defects in MEK1 can cause cardiofaciocutaneous syndrome.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Rampoldi L, et al. (1998) Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet Cell Genet. 78(3-4):301-3.
  • Zheng CF, et al. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. 268(15):11435-9.
  • Nantel, et al. (1998) Interaction of the Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem. 273(17):10475-84.
  • Hirata H, et al. (2012) I MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer. Carcinogenesis. 33(1):41-8.