Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid(NM_002424.2)

Product Information

NCBI RefSeq: NM_002424.2

RefSeq ORF Size: 1404

cDNA Description: Full length Clone DNA of Homo sapiens matrix metallopeptidase 8 (neutrophil collagenase).

Gene Synonym: CLG1,HNC,MMP-8,PMNL-CL

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MMP-8 / MMP8 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid HG10254-UTLN pLV-untagged 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10254-CFLN pLV-C-FLAG 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10254-CHLN pLV-C-His 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10254-CMLN pLV-C-Myc 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10254-CYLN pLV-C-HA 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10254-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10254-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10254-NFLN pLV-N-Flag 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10254-NHLN pLV-N-His 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10254-NMLN pLV-N-Myc 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10254-NYLN pLV-N-HA 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10254-ANGLN pLV-N-GFPSpark 2-3 weeks
Human MMP-8 / MMP8 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10254-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Matrix metalloproteinases (MMPs) are a family of zinc-dependent endopeptidases that degrade components of the extracellular matrix (ECM) and play essential roles in various physiological processes such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. Neutrophil collagenase, also known as Matrix metalloproteinase-8, MMP-8, and CLG1, is a member of the peptidase M10A family. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 in the tumour may have a protective effect against lymph node metastasis. MMP-8 may affect the metastatic behaviour of breast cancer cells through protection against lymph node metastasis, underlining the importance of anti-target identification in drug development. MMP-8 participates in wound repair by contributing to the resolution of inflammation and open the possibility to develop new strategies for treating wound healing defects.

Reference

  • Hasty K.A., et al.,(1990), Human neutrophil collagenase. A distinct gene product with homology to other matrix metalloproteinases. J. Biol. Chem. 265:11421-11424.
  • Blaeser J., et al., (1991), Mercurial activation of human polymorphonuclear leucocyte procollagenase.Eur. J. Biochem. 202:1223-1230.
  • Blaeser J., et al.,(1991), Mercurial activation of human polymorphonuclear leucocyte procollagenase. Eur. J. Biochem. 202:1223-1230.