Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human MTOR Gene Lentiviral ORF cDNA expression plasmid(NM_004958.3)

Product Information

NCBI RefSeq: NM_004958.3

RefSeq ORF Size: 7650

cDNA Description: Full length Clone DNA of Homo sapiens mechanistic target of rapamycin (serine/threonine kinase) with C terminal OFPSpark / RFP tag.

Gene Synonym: FRAP,FRAP1,FRAP2,RAFT1,RAPT1,SKS

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human MTOR Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human MTOR Gene Lentiviral ORF cDNA expression plasmid HG11508-UTLN pLV-untagged 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11508-CFLN pLV-C-FLAG 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11508-CHLN pLV-C-His 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11508-CMLN pLV-C-Myc 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11508-CYLN pLV-C-HA 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11508-ACGLN pLV-C-GFPSpark 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11508-ACRLN pLV-C-OFPSpark 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11508-NFLN pLV-N-Flag 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11508-NHLN pLV-N-His 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11508-NMLN pLV-N-Myc 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11508-NYLN pLV-N-HA 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11508-ANGLN pLV-N-GFPSpark 2-3 weeks
Human MTOR Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11508-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

The protein encoded by MTOR gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Zhao J, Zhai B, Gygi SP, Goldberg AL. mTOR inhibition activates overall protein degradation by the ubiquitin proteasome system as well as by autophagy. Proceedings of the National Academy of Sciences of the United States of America. 2015;112(52):15790-15797.