Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid(NM_139012.1)

Product Information

NCBI RefSeq: NM_139012.1

RefSeq ORF Size: 1083

cDNA Description: Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 14 transcript variant 2.

Gene Synonym: CSBP,CSBP1,CSBP2,CSPB1,EXIP,Mxi2,p38,p38ALPHA,PRKM14,PRKM15,RK,SAPK2A

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human p38 alpha/MAPK14 transcript variant 2 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid HG10081-UTLN pLV-untagged 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10081-CFLN pLV-C-FLAG 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10081-CHLN pLV-C-His 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10081-CMLN pLV-C-Myc 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10081-CYLN pLV-C-HA 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10081-ACGLN pLV-C-GFPSpark 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10081-ACRLN pLV-C-OFPSpark 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10081-NFLN pLV-N-Flag 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10081-NHLN pLV-N-His 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10081-NMLN pLV-N-Myc 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10081-NYLN pLV-N-HA 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10081-ANGLN pLV-N-GFPSpark 2-3 weeks
Human p38 alpha/MAPK14 transcript variant 2 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10081-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

MAPK14 contains 1 protein kinase domain and belongs to the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. MAPK14 can be detected in brain, heart, placenta, pancreas and skeletal muscle and it is expressed to a lesser extent in lung, liver and kidney. MAPK14 is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with MAPK14. The substrates of p38 alpha include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of p38 alpha in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. In respond to activation by environmental stress, pro-inflammatory cytokines and lipopolysaccharide, MAPK14 phosphorylates a number of transcription factors, such as ELK1 and ATF2 and several downstream kinases, such as MAPKAPK2 and MAPKAPK5. MAPK14 plays a critical role in the production of some cytokines, for example IL-6. It may play a role in stabilization of EPO mRNA during hypoxic stress. Isoform Mxi2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2.

Reference

  • Luo X, et al. (2011) Study on p38 mitogen activated protein kinase in vascular endothelial cells dysfunction in preeclampsia. Zhonghua Fu Chan Ke Za Zhi. 46(1):36-40.
  • Park CH, et al. (2011) Epidermal growth factor-induced matrix metalloproteinase-1 expression is negatively regulated by p38 MAPK in human skin fibroblasts. J Dermatol Sci. 64(2):134-41.
  • Lee JY, et al. (2011) Curcumin induces EGFR degradation in lung adenocarcinoma and modulates p38 activation in intestine: the versatile adjuvant for gefitinib therapy. PLoS One. 6(8):e23756.
  • Riis JL, et al. (2011) CCL27 expression is regulated by both p38 MAPK and IKKβ signalling pathways. Cytokine. 56(3):699-707.