Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid(NM_000546.4)

Product Information

NCBI RefSeq: NM_000546.4

RefSeq ORF Size: 1182

cDNA Description: Full length Clone DNA of Homo sapiens tumor protein p53 (TP53), transcript variant 1.

Gene Synonym: BCC7,LFS1,P53,TRP53

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human p53 transcript variant 1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid HG10182-UTLN pLV-untagged 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10182-CFLN pLV-C-FLAG 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10182-CHLN pLV-C-His 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10182-CMLN pLV-C-Myc 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10182-CYLN pLV-C-HA 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10182-ACGLN pLV-C-GFPSpark 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10182-ACRLN pLV-C-OFPSpark 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10182-NFLN pLV-N-Flag 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10182-NHLN pLV-N-His 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10182-NMLN pLV-N-Myc 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10182-NYLN pLV-N-HA 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10182-ANGLN pLV-N-GFPSpark 2-3 weeks
Human p53 transcript variant 1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10182-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

p53, also known as Tp53, is a DNA-binding protein which belongs to the p53 family. It contains transcription activation, DNA-binding, and oligomerization domains. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 (TP53) is a transcription factor whose protein levels and post-translational modification state alter in response to cellular stress (such as DNA damage, hypoxia, spindle damage). Activation of p53 begins through a number of mechanisms including phosphorylation by ATM, ATR, Chk1 and MAPKs. MDM2 is a ubiquitn ligase that binds p53 and targets p53 for proteasomal degradation. Phosphorylation, p14ARF and USP7 prevent MDM2-p53 interactions, leading to an increase in stable p53 tetramers in the cytoplasm. Further modifications such as methylation and acetylation lead to an increase in Tp53 binding to gene specific response elements. Tp53 regulates a large number of genes (>100 genes) that control a number of key tumor suppressing functions such as cell cycle arrest, DNA repair, senescence and apoptosis. Whilst the activation of p53 often leads to apoptosis, p53 inactivation facilitates tumor progression. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mutants of p53 that frequently occur in a number of different human cancers fail to bind the consensus DNA binding site, and hence cause the loss of tumor suppressor activity. Defects in TP53 are a cause of esophageal cancer, Li-Fraumeni syndrome, lung cancer and adrenocortical carcinoma.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Bakhrat A, et al. (2010) Drosophila Chk2 and p53 proteins induce stage-specific cell death independently during oogenesis. Apoptosis. 15(12):1425-34.
  • Kurzhals RL, et al. (2011) Chk2 and p53 are haploinsufficient with dependent and independent functions to eliminate cells after telomere loss. PLoS Genet. 7(6):e1002103.
  • Pardi N, et al. (2011) In vivo effects of abolishing the single canonical sumoylation site in the C-terminal region of Drosophila p53. Acta Biol Hung. 62(4):397-412.
  • Wells BS, et al. (2012) Maintenance of imaginal disc plasticity and regenerative potential in Drosophila by p53. Dev Biol. 361(2):263-76.