Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid(NM_016205.1)

Product Information

NCBI RefSeq: NM_016205.1

RefSeq ORF Size: 1038

cDNA Description: Full length Clone DNA of Homo sapiens platelet derived growth factor C.

Gene Synonym: FALLOTEIN,SCDGF

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PDGF-C Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid HG10273-UTLN pLV-untagged 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10273-CFLN pLV-C-FLAG 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10273-CHLN pLV-C-His 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10273-CMLN pLV-C-Myc 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10273-CYLN pLV-C-HA 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10273-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10273-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10273-NFLN pLV-N-Flag 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10273-NHLN pLV-N-His 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10273-NMLN pLV-N-Myc 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10273-NYLN pLV-N-HA 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10273-ANGLN pLV-N-GFPSpark 2-3 weeks
Human PDGF-C Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10273-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

PDGF-C is a member of the PDGF/VEGF family of growth factors with a unique domain organization and expression pattern. Platelet-derived growth factor receptors (PDGFRs) are catalytic receptors that have intracellular tyrosine kinase activity. They have roles in the regulation of many biological processes including embryonic development, angiogenesis, cell proliferation and differentiation, and contribute to the pathophysiology of some diseases, including cancer. There are two isoforms of the PDGFR receptor; PDGFRalpha and PDGFRbeta, which can form homo- or heterodimers. The endogenous PDGFR ligands are PDGF-A, -B, -C and -D, which induce receptor dimerization and transphosphorylation at specific tyrosine residues upon binding. This activates the intracellular kinase activity, initiating intracellular signaling through the MAPK, PI 3-K and PKCgamma pathways. PDGF-C acts as a specific ligand for alpha platelet-derived growth factor receptor homodimer, and alpha and beta heterodimer. Binding of this growth factor to its affinity receptor elicits a variety of cellular responses. PDGF-C Appears to be involved in the three stages of wound healing: inflammation, proliferation and remodeling. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs.

Reference

  • Li X, et al. (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol. 2 (5): 302-9.
  • Ding H, et al. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling. Nat Genet. 36 (10): 1111-6.
  • Choi SJ, et al. (2009) The PDGF-C regulatory region SNP rs28999109 decreases promoter transcriptional activity and is associated with CL/P. European Journal of Human Genetics. 17 (11): 774-84.