Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid(BC114432)

Product Information

NCBI RefSeq: BC114432

RefSeq ORF Size: 3213

cDNA Description: Full length Clone DNA of Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta.

Gene Synonym: P110BETA,PI3K,PI3KBETA,PIK3C1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PIK3CB Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid HG11961-UTLN pLV-untagged 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11961-CFLN pLV-C-FLAG 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11961-CHLN pLV-C-His 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11961-CMLN pLV-C-Myc 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11961-CYLN pLV-C-HA 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11961-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11961-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11961-NFLN pLV-N-Flag 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11961-NHLN pLV-N-His 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11961-NMLN pLV-N-Myc 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11961-NYLN pLV-N-HA 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11961-ANGLN pLV-N-GFPSpark 2-3 weeks
Human PIK3CB Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11961-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

PIK3CB gene encodes an isoform of the catalytic subunit of phosphoinositide 3-kinase (PI3K). These kinases are important in signaling pathways involving receptors on the outer membrane of eukaryotic cells and are named for their catalytic subunit. The encoded protein is the catalytic subunit for PI3Kbeta (PI3KB). PI3KB has been shown to be part of the activation pathway in neutrophils which have bound immune complexes at sites of injury or infection. Alternative splicing results in multiple transcript variants.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Draaisma K, Wijnenga MMJ, Weenink B, et al. PI3 kinase mutations and mutational load as poor prognostic markers in diffuse glioma patients. Acta Neuropathologica Communications.