Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid(NM_005026.3)

Product Information

NCBI RefSeq: NM_005026.3

RefSeq ORF Size: 3135

cDNA Description: Full length Clone DNA of Homo sapiens phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta

Gene Synonym: APDS,IMD14,p110D,P110DELTA,PI3K

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PIK3CD Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid HG18097-UTLN pLV-untagged 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG18097-CFLN pLV-C-FLAG 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG18097-CHLN pLV-C-His 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG18097-CMLN pLV-C-Myc 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG18097-CYLN pLV-C-HA 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG18097-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG18097-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG18097-NFLN pLV-N-Flag 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG18097-NHLN pLV-N-His 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG18097-NMLN pLV-N-Myc 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG18097-NYLN pLV-N-HA 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG18097-ANGLN pLV-N-GFPSpark 2-3 weeks
Human PIK3CD Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG18097-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I PI3K found primarily in leukocytes. Like other class I PI3Ks (p110-alpha p110-beta, and p110-gamma), the encoded protein binds p85 adapter proteins and GTP-bound RAS. However, unlike the other class I PI3Ks, this protein phosphorylates itself, not p85 protein.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Poopal AC, Schroeder LM, Horn PS, Bassell GJ, Gross C. Increased expression of the PI3K catalytic subunit p110