Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human PTEN Gene Lentiviral ORF cDNA expression plasmid(NM_000314.4)

Product Information

NCBI RefSeq: NM_000314.4

RefSeq ORF Size: 1212

cDNA Description: Full length Clone DNA of Homo sapiens phosphatase and tensin homolog (PTEN).

Gene Synonym: 10q23del,BZS,CWS1,DEC,GLM2,MHAM,MMAC1,PTEN1,TEP1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human PTEN Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human PTEN Gene Lentiviral ORF cDNA expression plasmid HG10421-UTLN pLV-untagged 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10421-CFLN pLV-C-FLAG 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10421-CHLN pLV-C-His 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10421-CMLN pLV-C-Myc 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10421-CYLN pLV-C-HA 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10421-ACGLN pLV-C-GFPSpark 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10421-ACRLN pLV-C-OFPSpark 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10421-NFLN pLV-N-Flag 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10421-NHLN pLV-N-His 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10421-NMLN pLV-N-Myc 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10421-NYLN pLV-N-HA 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10421-ANGLN pLV-N-GFPSpark 2-3 weeks
Human PTEN Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10421-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

PTEN gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Shinde SR, Maddika S. PTEN modulates EGFR late endocytic trafficking and degradation by dephosphorylating Rab7. Nature Communications. 2016;7:10689.