Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid(NM_003404.3)

Product Information

NCBI RefSeq: NM_003404.3

RefSeq ORF Size: 741

cDNA Description: Full length Clone DNA of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide.

Gene Synonym: GW128,HEL-S-1,HS1,KCIP-1,YWHAA

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human 14-3-3 beta/YWHAB Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid HG10843-UTLN pLV-untagged 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10843-CFLN pLV-C-FLAG 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10843-CHLN pLV-C-His 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10843-CMLN pLV-C-Myc 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10843-CYLN pLV-C-HA 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10843-ACGLN pLV-C-GFPSpark 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10843-ACRLN pLV-C-OFPSpark 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10843-NFLN pLV-N-Flag 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10843-NHLN pLV-N-His 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10843-NMLN pLV-N-Myc 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10843-NYLN pLV-N-HA 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10843-ANGLN pLV-N-GFPSpark 2-3 weeks
Human 14-3-3 beta/YWHAB Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10843-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.

Reference

  • Tommerup N, et al. (1996) Assignment of the human genes encoding 14,3-3 Eta (YWHAH) to 22q12, 14-3-3 zeta (YWHAZ) to 2p25.1-p25.2, and 14-3-3 beta (YWHAB) to 20q13.1 by in situ hybridization. Genomics. 33(1): 149-50.
  • Jin YH, et al. (2008) Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun. 368(3): 690-5.
  • Sekimoto T, et al. (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J. 23(9): 1934-42.