Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid(NM_006761.4)

Product Information

NCBI RefSeq: NM_006761.4

RefSeq ORF Size: 768

cDNA Description: Full length Clone DNA of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide.

Gene Synonym: 14-3-3E,HEL2,KCIP-1,MDCR,MDS

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human 14-3-3 epsilon/YWHAE Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid HG10842-UTLN pLV-untagged 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10842-CFLN pLV-C-FLAG 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10842-CHLN pLV-C-His 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10842-CMLN pLV-C-Myc 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10842-CYLN pLV-C-HA 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10842-ACGLN pLV-C-GFPSpark 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10842-ACRLN pLV-C-OFPSpark 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10842-NFLN pLV-N-Flag 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10842-NHLN pLV-N-His 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10842-NMLN pLV-N-Myc 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10842-NYLN pLV-N-HA 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10842-ANGLN pLV-N-GFPSpark 2-3 weeks
Human 14-3-3 epsilon/YWHAE Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10842-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

YWHAE, also known as 14-3-3 epsilon, mediate signal transduction by binding to phosphoserine-containing proteins. 14-3-3 epsilon / YWHAE is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 epsilon / YWHAE is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. YWHAE interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 epsilon / YWHAE is implicated in the regulation of a large spectrum of both general and specialized signaling pathways. 14-3-3 epsilon / YWHAE Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. This Binding generally results in the modulation of the activity of the binding partner.

Reference

  • Ikeda M, et al. (2008) Identification of YWHAE, a gene encoding 14-3-3epsilon, as a possible susceptibility gene for schizophrenia. Hum Mol Genet. 17(20): 3212-22.
  • Mignon-Ravix C, et al. (2010) Deletion of YWHAE in a patient with periventricular heterotopias and pronounced corpus callosum hypoplasia. J Med Genet. 47(2): 132-6.
  • Nagamani SC, et al. (2009) Microdeletions including YWHAE in the Miller-Dieker syndrome region on chromosome 17p13.3 result in facial dysmorphisms, growth restriction, and cognitive impairment. J Med Genet. 46(12): 825-33.