Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid(NM_005417.3)

Product Information

NCBI RefSeq: NM_005417.3

RefSeq ORF Size: 1611

cDNA Description: Full length Clone DNA of Homo sapiens v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian).

Gene Synonym: ASV,c-SRC,p60-Src,SRC1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human SRC/Proto-oncogene c-Src Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid HG10755-UTLN pLV-untagged 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10755-CFLN pLV-C-FLAG 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10755-CHLN pLV-C-His 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10755-CMLN pLV-C-Myc 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10755-CYLN pLV-C-HA 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10755-ACGLN pLV-C-GFPSpark 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10755-ACRLN pLV-C-OFPSpark 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10755-NFLN pLV-N-Flag 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10755-NHLN pLV-N-His 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10755-NMLN pLV-N-Myc 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10755-NYLN pLV-N-HA 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10755-ANGLN pLV-N-GFPSpark 2-3 weeks
Human SRC/Proto-oncogene c-Src Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10755-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Proto-oncogene tyrosine-protein kinase SRC is a hydrophobic protein belonging to the SRC family kinase including nine members that is a family of non-receptor tyrosine kinases. SRC protein may exist in different forms: C-SRC and V-SRC. C-SRC is only activated under certain circumstances where it is required such as growth factor signaling, while V-SRC is a constitutively active as opposed to normal SRC (C-SRC). Thus, V-SRC is an instructive example of an oncogene protein kinase whereas C-SRC is a proto-oncogene protein kinase. Inhibition of SRC with NR2A tyrosine phosphorylation mediated by PSD-95 may contribute to the lithium-induced downregulation of NMDA receptor function and provide neuroprotection against excitotoxicity.

Reference

  • Juan Ma. et al., 2003, Neuroscience Letters. 348 (3): 185-189.
  • Czernilofsky AP. et al., 1980, Nature. 287: 198-203.
  • Beischlag TV. et al., 2002, Molecular and cellular biology. 22 (12): 4319-33.