Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid(NM_003352.4)

Product Information

NCBI RefSeq: NM_003352.4

RefSeq ORF Size: 306

cDNA Description: Full length Clone DNA of Homo sapiens small ubiquitin-like modifier 1.

Gene Synonym: DAP1,GMP1,OFC10,PIC1,SENP2,SMT3,SMT3C,SMT3H3,UBL1

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human SUMO1/SUMO-1 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid HG13095-UTLN pLV-untagged 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13095-CFLN pLV-C-FLAG 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13095-CHLN pLV-C-His 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13095-CMLN pLV-C-Myc 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13095-CYLN pLV-C-HA 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13095-ACGLN pLV-C-GFPSpark 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13095-ACRLN pLV-C-OFPSpark 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13095-NFLN pLV-N-Flag 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13095-NHLN pLV-N-His 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13095-NMLN pLV-N-Myc 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13095-NYLN pLV-N-HA 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG13095-ANGLN pLV-N-GFPSpark 2-3 weeks
Human SUMO1/SUMO-1 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG13095-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

Reference

  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.