Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid(BC109392)

Product Information

NCBI RefSeq: BC109392

RefSeq ORF Size: 744

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 13B.

Gene Synonym: CD267,CVID,CVID2,IGAD2,RYZN,TACI,TNFRSF14B

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TACI/TNFRSF13B(CD267) Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid HG11937-UTLN pLV-untagged 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG11937-CFLN pLV-C-FLAG 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG11937-CHLN pLV-C-His 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG11937-CMLN pLV-C-Myc 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG11937-CYLN pLV-C-HA 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG11937-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG11937-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG11937-NFLN pLV-N-Flag 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG11937-NHLN pLV-N-His 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG11937-NMLN pLV-N-Myc 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG11937-NYLN pLV-N-HA 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG11937-ANGLN pLV-N-GFPSpark 2-3 weeks
Human TACI/TNFRSF13B(CD267) Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG11937-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

Tumor necrosis factor receptor superfamily, member 13B (TNFRSF13B) also known as Transmembrane activator and CAML interactor (TACI) and CD267 antigen, is a member of the tumor necrosis factor receptor superfamily. TNFRSF13B is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. TACI/TNFRSF13B/CD267 induces activation of the transcription factors NFAT, AP1, and NF-kappa-B and plays a crucial role in humoral immunity by interacting with a TNF ligand.

Reference

  • Salzer U, et al. (2005) Mutations in TNFRSF13B encoding TACI are associated with common variable immunodeficiency in humans. Nat Genet. 37(8): 820-8.
  • Salzer U, et al. (2009) Relevance of biallelic versus monoallelic TNFRSF13B mutations in distinguishing disease-causing from risk-increasing TNFRSF13B variants in antibody deficiency syndromes. Blood. 113(9): 1967-76.
  • Mohammadi J, et al. (2009) Novel mutations in TACI (TNFRSF13B) causing common variable immunodeficiency. J Clin Immunol. 29(6): 777-85.