Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid(BC069319)

Product Information

NCBI RefSeq: BC069319

RefSeq ORF Size: 534

cDNA Description: Full length Clone DNA of Homo sapiens tumor necrosis factor (ligand) superfamily, member 18.

Gene Synonym: AITRL,GITRL,hGITRL,TL6

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human TNFSF18 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid HG13058-UTLN pLV-untagged 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG13058-CFLN pLV-C-FLAG 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG13058-CHLN pLV-C-His 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG13058-CMLN pLV-C-Myc 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG13058-CYLN pLV-C-HA 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG13058-ACGLN pLV-C-GFPSpark 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG13058-ACRLN pLV-C-OFPSpark 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG13058-NFLN pLV-N-Flag 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG13058-NHLN pLV-N-His 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG13058-NMLN pLV-N-Myc 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG13058-NYLN pLV-N-HA 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG13058-ANGLN pLV-N-GFPSpark 2-3 weeks
Human TNFSF18 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG13058-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for receptor TNFRSF18/AITR/GITR. It has been shown to modulate T lymphocyte survival in peripheral tissues. This cytokine is also found to be expressed in endothelial cells, and is thought to be important for interaction between T lymphocytes and endothelial cells.

Immune Checkpoint
Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Reference

  • Liu Y, Tang X, Tian J, et al. Th17/Treg Cells Imbalance and GITRL Profile in Patients with Hashimoto