Why we recommend for using lentivirus vectors?

  • Lentivirus, a type of retrovirus, has become one of the most popular gene delivery tools in the lab.
  • Lentivirus can transduce almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.
  • It also has the advantage to be used for either transient or stable expression.

More Products

Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid(NM_004300.3)

Product Information

NCBI RefSeq: NM_004300.3

RefSeq ORF Size: 477

cDNA Description: Full length Clone DNA of Homo sapiens acid phosphatase 1, soluble , transcript variant 3.

Gene Synonym: HAAP

Species: Human

Sequence Description: Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)

Sequencing primers: pLen-F(CTCGTTTAGTGAACCGTCAGAATT),pLen-R(GAACCGGAACCCTTAAACATGT)

Promoter: Enhanced CMV mammalian cell promoter

Application: Stable or Transient expression in almost any mammalian cell type, including dividing and nondividing cells, primary cell cultures, stem cells, and neurons with high efficiency.

Antibiotic in E.coli: Ampicillin

Shipping carrier: Each tube contains 10

Storage: The lyophilized plasmid can be stored at room temperature for three months

Human ACP1 / LMW-PTP transcript variant 3 Gene Cloned in Lentiviral Vectors of Various Tags

Description Catalog Vector Sequence Data Sheet Availability
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid HG10957-UTLN pLV-untagged 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-Flag tag HG10957-CFLN pLV-C-FLAG 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-His tag HG10957-CHLN pLV-C-His 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-Myc tag HG10957-CMLN pLV-C-Myc 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-HA tag HG10957-CYLN pLV-C-HA 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag HG10957-ACGLN pLV-C-GFPSpark 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, C-OFPSpark tag HG10957-ACRLN pLV-C-OFPSpark 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-Flag tag HG10957-NFLN pLV-N-Flag 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-His tag HG10957-NHLN pLV-N-His 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-Myc tag HG10957-NMLN pLV-N-Myc 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-HA tag HG10957-NYLN pLV-N-HA 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-GFPSpark tag HG10957-ANGLN pLV-N-GFPSpark 2-3 weeks
Human ACP1 / LMW-PTP transcript variant 3 Gene Lentiviral ORF cDNA expression plasmid, N-OFPSpark tag HG10957-ANRLN pLV-N-OFPSpark 2-3 weeks

Background

The low molecular weight phosphotyrosine phosphatase (LMW-PTP), also known as Acid phosphatase 1 (ACP1), belongs to the low molecular weight phosphotyrosine protein phosphatase family are involved in the regulation of important physiological functions, including stress resistance and synthesis of the polysaccharide capsule. ACP1/LMW-PTP is an enzyme involved in platelet-derived growth factor-induced mitogenesis and cytoskeleton rearrangement. LMW-PTP is able to specifically bind and dephosphorylate activated PDGF receptor, thus modulating PDGF-induced mitogenesis. In vitro, LMW-PTP was found to efficiently dephosphorylate activated FcgammaRIIA and LAT, but not Syk or phospholipase Cgamma2. The overexpression of LMW-PTP inhibited activation of Syk downstream of FcgammaRIIA and reduced intracellular Ca(2+) mobilization. It been demonstrated that LMW-PTP is responsible for FcgammaRIIA dephosphorylation, and is implicated in the down-regulation of cell activation mediated by this ITAM-bearing immunoreceptor. In addition, ACP1 is a highly polymorphic phosphatase that is especially abundant in the central nervous system and is known to be involved in several signal transduction pathways.

Reference

  • Cirri P, et al. (1998) Low molecular weight protein-tyrosine phosphatase tyrosine phosphorylation by c-Src during platelet-derived growth factor-induced mitogenesis correlates with its subcellular targeting. J Biol Chem. 273(49): 32522-7.
  • Chiarugi P, et al. (2002) Insight into the role of low molecular weight phosphotyrosine phosphatase (LMW-PTP) on platelet-derived growth factor receptor (PDGF-r) signaling. LMW-PTP controls PDGF-r kinase activity through TYR-857 dephosphorylation. J Biol Chem. 277(40): 37331-8.
  • Bottini N, et al. (2002) Convulsive disorder and the genetics of signal transduction; a study of a low molecular weight protein tyrosine phosphatase in a pediatric sample. Neurosci Lett. 333(3): 159-62.
  • Musumeci L, et al. (2005) Low-molecular-weight protein tyrosine phosphatases of Bacillus subtilis. J Bacteriol. 187(14): 4945-56.
  • Mancini F, et al. (2007) The low-molecular-weight phosphotyrosine phosphatase is a negative regulator of FcgammaRIIA-mediated cell activation. Blood. 110(6): 1871-8.